Sequence ID | >WENV170644781 |
Genome ID | JMBW01092516 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 85 |
End posion on genome | 178 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ttaagatcaa |
tRNA gene sequence |
GGAGAGATGGCCGAGCTGGCTGAAGGCGCTCGCCTGCTAAGCGAGTAAGCGGTGAATAGC |
Downstream region at tRNA end position |
ttcttaccag |
Secondary structure (Cloverleaf model) | >WENV170644781 Ser GCT a GCCA ttcttaccag G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T C G A G | | | | | A G G C C G G A G G G C G | | | T T C A G G C T G A G TAAGCGGTGAATAGCTGCTTC C - G T - A C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |