Sequence ID | >WENV170644784 |
Genome ID | JMBW01093457 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 121 |
End posion on genome | 32 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aactaaataa |
tRNA gene sequence |
GCCGCGGTGGCGGAATCGGCAGACGCAGCAGACTCAAAATCTGCCGTACGTAAGTACGTG |
Downstream region at tRNA end position |
gtatattcag |
Secondary structure (Cloverleaf model) | >WENV170644784 Leu CAA a ACCA gtatattcag G - C C - G C - G G - C C - G G - C G - C T G T T T C C C A T A A G + + | | | A C G G C G G G G G G C G | | | T T G A C G C C A G A CGTACGTAAGTACGTGGG G - C C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |