Sequence ID | >WENV170644787 |
Genome ID | JMBW01093871 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 61 |
End posion on genome | 138 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ttggtcttgt |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTCTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCGA |
Downstream region at tRNA end position |
tttatttggg |
Secondary structure (Cloverleaf model) | >WENV170644787 Ile GAT t ACCA tttatttggg G - C G - C G - C C - G C - G T - A A - T T A T C C A T C A T T G A A | | | + | G G C T C G G G T G G C G | | | | T T T G A G C C T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |