Sequence ID | >WENV170644788 |
Genome ID | JMBW01093956 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 61 |
End posion on genome | 137 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aggtagttac |
tRNA gene sequence |
CGCGGGGGGTAGAGCAGTGGAAGCTCGTTAGGCTCATAACCTAAAGGTCGCTGGTTCGAA |
Downstream region at tRNA end position |
tttttctact |
Secondary structure (Cloverleaf model) | >WENV170644788 Met CAT c ACCA tttttctact C A G - C C - G G - C G - C G - C G - C T A G C G A C C A A C G G | | | | | G G A G A T G C T G G C T | | T T G G C T C G A A G AGGTC T - A T - A A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |