Sequence ID | >WENV170644795 |
Genome ID | JMBW01096228 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 183 |
End posion on genome | 101 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
caatagtccc |
tRNA gene sequence |
GCGGATATGGTGGAATTGGCAGACACGCTGGATTTAGGTTCCAGTGGGAAACCGTGCAGG |
Downstream region at tRNA end position |
cacctgcggt |
Secondary structure (Cloverleaf model) | >WENV170644795 Leu TAG c ACCA cacctgcggt G - C C - G G - C G - C A - T T - A A - T T G T T G T C C A T A A G + | | | | G T G G T G G C A G G C G | | | T T G A C A C C A G G TGGGAAACCGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |