Sequence ID | >WENV170644796 |
Genome ID | JMBW01097005 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 204 |
End posion on genome | 128 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
atagaaatat |
tRNA gene sequence |
GCACCCGTAGCTCAATTGGATAGAGTAGCTGGCTTCGAACCAGTTGGTTGGGGGTTCGAG |
Downstream region at tRNA end position |
agcttaaacc |
Secondary structure (Cloverleaf model) | >WENV170644796 Arg TCG t ACCA agcttaaacc G + T C - G A - T C - G C - G C - G G - C T G T C T C C C A T A A A | + | | | G T C T C G G G G G G C G | | | + T T G G A G T A T A A TGGTT G + T C - G T - A G - C G - C C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |