Sequence ID | >WENV170644797 |
Genome ID | JMBW01097008 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 157 |
End posion on genome | 83 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tcttatcttT |
tRNA gene sequence |
GGGCTCGTAGATCAGGGGTTAGATCGTTTCGTTCGCAACGAAAAGGCCGCGGGTTCAAAT |
Downstream region at tRNA end position |
tctgtttctc |
Secondary structure (Cloverleaf model) | >WENV170644797 Ala CGC T ATgt tctgtttctc G - C G - C G + T C - G T - A C - G G - C T A T C G C C C A G G A A | | | | | A G C T A G G C G G G C G | | | | T T T G A T C T A G AGGCC T - A T - A T - A C - G G - C T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |