Sequence ID | >WENV170644798 |
Genome ID | JMBW01097764 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 141 |
End posion on genome | 217 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ggagttacgg |
tRNA gene sequence |
GGGGGCGTGGCTCAGTTTGGTAGAGCGTCGCGTTCGGGACGCGAAGGCCGCACGTTCAAA |
Downstream region at tRNA end position |
tctttaatta |
Secondary structure (Cloverleaf model) | >WENV170644798 Pro CGG g ACCA tctttaatta G G G - C G - C G - C G - C C - G G - C T A T T G T G C A T G A G + | | | | A T C T C G G C A C G C T | | | | T T G G A G C G T A G AGGCC T - A C - G G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |