Sequence ID | >WENV170644801 |
Genome ID | JMBW01098086 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 102 |
End posion on genome | 182 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
attgcgtcgg |
tRNA gene sequence |
GGGGGCGTGGCGCAGCTTGGCTAGCGCGCTACCTTGGGGGGGTGGTAGAGGTCGCAAGTT |
Downstream region at tRNA end position |
ctttttttta |
Secondary structure (Cloverleaf model) | >WENV170644801 Pro GGG g ACCA ctttttttta G G G - C G - C G - C G - C C - G G - C T A T T G T T C A T C G A G + | | | | A T C G C G G C A A G C G | | | | T T G G C G C C T A G TAGAGGTC C - G T + G A - T C - G C - G T G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |