Sequence ID | >WENV170644802 |
Genome ID | JMBW01099829 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 101 |
End posion on genome | 26 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gaccctatat |
tRNA gene sequence |
GAGCCATTAGCTCAGGTGGCAGAGCACCTGACTTTTAATCAGGGTGTCGGAGGTTCGAGT |
Downstream region at tRNA end position |
ttttcttaaa |
Secondary structure (Cloverleaf model) | >WENV170644802 Lys TTT t ACCA ttttcttaaa G - C A - T G - C C - G C - G A - T T - A T G T T C T C C A G G A A + | | | | G T C T C G G G A G G C G | | | | T T G G A G C C A A GTGTC C - G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |