Sequence ID | >WENV170644805 |
Genome ID | JMBW01103604 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 96 |
End posion on genome | 173 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tatagatatG |
tRNA gene sequence |
GTGGGTATAGCTCAATTGGTTAGAGCGCTGGTTTGTGGCACCAGAGGTTGTGGGTTCAAC |
Downstream region at tRNA end position |
ccagatggta |
Secondary structure (Cloverleaf model) | >WENV170644805 His GTG G CCCC ccagatggta G - C T - A G - C G + T G - C T - A A - T T C T T A C C C A T A A A + | | | | A T C T C G G T G G G C G | | | | T T G G A G C T T A G AGGTT C - G T - A G - C G - C T - A T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |