Sequence ID | >WENV170644812 |
Genome ID | JMBW01107274 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 125 |
End posion on genome | 48 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aagagacacG |
tRNA gene sequence |
GTGGAATTAGCTCAGTCGGTTAGAGTGCCAGGTTGTGGCCCTGGAGGTCGTGGGTTCGAT |
Downstream region at tRNA end position |
ccatctttta |
Secondary structure (Cloverleaf model) | >WENV170644812 His GTG G CCCC ccatctttta G - C T - A G - C G - C A - T A - T T - A T T T T A C C C A T G A A + | | | | G C C T C G G T G G G C G | | | + T T G G A G T T T A G AGGTC C - G C - G A - T G - C G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |