Sequence ID | >WENV170644815 |
Genome ID | JMBW01110170 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 95 |
End posion on genome | 9 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
catcctgaaa |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCACTAGCTTCAGGTGCTAGCGCTCGCAAGGGCGTG |
Downstream region at tRNA end position |
aaaaaaacnn |
Secondary structure (Cloverleaf model) | >WENV170644815 Leu CAG a ACCA aaaaaaacnn G - C C - G C - G C - G A - T G - C G - C T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G A CGCTCGCAAGGGCGT C - G T - A A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |