Sequence ID | >WENV170644818 |
Genome ID | JMBW01111818 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 145 |
End posion on genome | 223 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gtttaaaaat |
tRNA gene sequence |
GGGCGCTTAGCTCAGCTGGGAGAGCACCTGCCTTACAAGCAGGGGGGGGTCATAGGTTCG |
Downstream region at tRNA end position |
ggaaaataaa |
Secondary structure (Cloverleaf model) | >WENV170644818 Val TAC t ACCA ggaaaataaa G - C G - C G - C C - G G - C C - G T - A C G T T A T C C A C G A A | | | | | G T C T C G A T A G G C G | | | | T T G G A G C G A A GGGGGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |