Sequence ID | >WENV170644823 |
Genome ID | JMBW01114249 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 157 |
End posion on genome | 231 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
aataatgtgt |
tRNA gene sequence |
GCGGGTTTAACTCAGCGGTAGAGTGTCACCTTGCCAAGGTGAAAGTCGCGAGTTCAAATC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170644823 Gly GCC t TCCA nnnnnnnnnn G - C C - G G - C G - C G - C T - A T - A T A T T G C T C A G A A + | | | | A C C T C A G C G A G C G | | | | T T G G A G T T A G AAGTC T - A C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |