Sequence ID | >WENV170644824 |
Genome ID | JMBW01114524 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 228 |
End posion on genome | 153 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
nnnnnnnnaa |
tRNA gene sequence |
GGGCGAATAGCTCAGCTGGGAGAGTGCCTGGATCACACCCAGGAGGCCACAGGTTCGAGC |
Downstream region at tRNA end position |
atagtgcgga |
Secondary structure (Cloverleaf model) | >WENV170644824 Val CAC a ACCA atagtgcgga G - C G - C G - C C - G G - C A - T A - T C G T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | + T T G G A G T G A G AGGCC C - G C - G T - A G - C G - C A C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |