Sequence ID | >WENV170644828 |
Genome ID | JMBW01118673 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 77 |
End posion on genome | 4 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ccagtaacaa |
tRNA gene sequence |
GCGGGAGTGGCTCAGTGGTAGAGCGTCGCCTTGCCAAGGCGAATGCGCGGGTTCGAATCC |
Downstream region at tRNA end position |
ttannnnnnn |
Secondary structure (Cloverleaf model) | >WENV170644828 Gly GCC a TCCA ttannnnnnn G - C C - G G - C G - C G + T A - T G - C T A T T G C C C A G A G + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A G ATGC T - A C - G G - C C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |