Sequence ID | >WENV170644830 |
Genome ID | JMBW01120536 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 63 |
End posion on genome | 153 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ttgaaacacT |
tRNA gene sequence |
GGAGAATTGTCCGAGAGGCTGAAGGAGCACGATTGGAAATCGTGTAAACGGCCAACGCCG |
Downstream region at tRNA end position |
aaaataaata |
Secondary structure (Cloverleaf model) | >WENV170644830 Ser GGA T GTtt aaaataaata G - C G - C A - T G - C A - T A - T T - A T A T T T C C C A A G A G | | | | | A G G C C T A A G G G C G | | | T T C A G G A T G A G TAAACGGCCAACGCCGTTTC C - G A - T C - G G - C A - T T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |