Sequence ID | >WENV170644833 |
Genome ID | JMBW01121630 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 48 |
End posion on genome | 125 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
agcgcttcaC |
tRNA gene sequence |
GGGGGCGTGGCTCAGCCCGGATAGAGTGCACGGTTCGGGTCCGTGAGGTCGGCGGTTCAA |
Downstream region at tRNA end position |
aaataataat |
Secondary structure (Cloverleaf model) | >WENV170644833 Pro CGG C CGAc aaataataat G - C G - C G - C G - C G - C C C G G T A T C C G C C A C C G A G | | | | | A C C T C G G G C G G C G | | | + T T G G A G T A T A G AGGTC C - G A - T C - G G - C G - C T T T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |