Sequence ID | >WENV170644834 |
Genome ID | JMBW01121631 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 26 |
End posion on genome | 104 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
atgagatggg |
tRNA gene sequence |
GGGGCTTTGGCGAAGTTGGGATCGCGCCTGACTGGCAGTCAGGAGACCAGGGGGGGTTCG |
Downstream region at tRNA end position |
taaaatataa |
Secondary structure (Cloverleaf model) | >WENV170644834 Ala GGC g ACCA taaaatataa G - C G - C G + T G - C C - G T - A T - A T A T T C C C C A T G A G + | | | | G T A G C G G G G G G C G | | | | T T G T C G C G A G AGACCAGG C - G C - G T - A G - C A - T C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |