Sequence ID | >WENV170644837 |
Genome ID | JMBW01125338 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 207 |
End posion on genome | 131 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ttaatatgtg |
tRNA gene sequence |
GTGGGTGTGGCCTAGTTGGTTAAGGCGCCAGATTGTGGCTCTGGAGATCGTGGGTTCGAA |
Downstream region at tRNA end position |
tcgaccatta |
Secondary structure (Cloverleaf model) | >WENV170644837 His GTG g CCCA tcgaccatta G - C T - A G - C G - C G + T T - A G - C T A T T A C C C A T G A G + | | | | G T T C C G G T G G G C G | | | | T T G A G G C T T A G AGATC C - G C - G A - T G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |