Sequence ID | >WENV170644839 |
Genome ID | JMBW01125570 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 18 |
End posion on genome | 99 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
catccttatg |
tRNA gene sequence |
TGGCCCCTTGGTCAAGTGGTTAAGACACCGCCCTTTCACGGCGGTAACAGGGGGGGTTCG |
Downstream region at tRNA end position |
acataagggc |
Secondary structure (Cloverleaf model) | >WENV170644839 Glu TTC g CCAt acataagggc T - A G - C G + T C - G C - G C - G C - G C C T G G G A T C G A A T + + + C T C T G G G T T C G T G + | A G G A G A C T T A A TAACAGGGGGG C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |