Sequence ID | >WENV170644849 |
Genome ID | JMBW01131419 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 129 |
End posion on genome | 202 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ccaccataat |
tRNA gene sequence |
GCGGGTGTAGCTCAGTGGTAGAGCCCCAGCCTTCCAAGCTGGTTGCGAGGGTTCGATTCC |
Downstream region at tRNA end position |
cgacaggcan |
Secondary structure (Cloverleaf model) | >WENV170644849 Gly TCC t TCCA cgacaggcan G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A G A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A C TTGC C - G C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |