Sequence ID | >WENV170644851 |
Genome ID | JMBW01132989 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 10 |
End posion on genome | 84 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
nggtatttat |
tRNA gene sequence |
GCACTCGTAGCTCAATTGGATAGAGCAACGCACTCCTAACGCGTAGGTTGTAGGTTCAAT |
Downstream region at tRNA end position |
tagttggtta |
Secondary structure (Cloverleaf model) | >WENV170644851 Arg CCT t GCtt tagttggtta G - C C - G A - T C - G T - A C - G G - C T T T C G T C C A T A A A | + | | | A T C T C G G T A G G C G | | | | T T G G A G C A T A A AGGTT A - T C - G G - C C - G A C C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |