Sequence ID | >WENV170644856 |
Genome ID | JMBW01138101 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 183 |
End posion on genome | 107 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gccacgtaat |
tRNA gene sequence |
GCGCCCGTAGCTCAGTTGGATAGAGTGCCTGACTACGAATCAGGAGGCCATAGGTTCGAA |
Downstream region at tRNA end position |
ttgcaaatga |
Secondary structure (Cloverleaf model) | >WENV170644856 Arg ACG t ACCA ttgcaaatga G - C C - G G - C C - G C - G C - G G - C T A T T G T C C A T G A A | + | | | G T C T C G A T A G G C G | | | + T T G G A G T A T A G AGGCC C - G C - G T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |