Sequence ID | >WENV170644857 |
Genome ID | JMBW01138684 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 36 |
End posion on genome | 111 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
actatgacag |
tRNA gene sequence |
GCACCTATAGCTCAGTAGGATAGAGCAACGGACTTCTAATCCGTGTGCCGGGGTTCGAAT |
Downstream region at tRNA end position |
ggcgttaata |
Secondary structure (Cloverleaf model) | >WENV170644857 Arg TCT g GCCA ggcgttaata G - C C - G A - T C - G C - G T - A A - T T A T C C T C C A T G A A | + | | G A C T C G C G G G G C G | | | | T T G G A G C A T A A GTGC A - T C - G G - C G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |