Sequence ID | >WENV170644863 |
Genome ID | JMBW01140291 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 125 |
End posion on genome | 202 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccaactttat |
tRNA gene sequence |
GGCCCTGTGGTCAAGCGGTTAAGACATCGCCCTTTCACGGCGGTATCAGGGGGGGTTCGA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170644863 Glu TTC t ACCA nnnnnnnnnn G - C G + T C - G C - G C - G T - A G - C T G T T C C C C A C G A G + | | | | G G A C T G G G G G G C G | | | T T T A G A C T A A TATCAGG T + G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |