Sequence ID | >WENV170644865 |
Genome ID | JMBW01141213 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 155 |
End posion on genome | 80 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttatttaaat |
tRNA gene sequence |
CGCGGAGTAGAGCAGCTGGTAGCTTGTCGGGCTCATAACCCGGAGGTCGTAGGTTCGAAT |
Downstream region at tRNA end position |
acttagacag |
Secondary structure (Cloverleaf model) | >WENV170644865 Met CAT t ACCA acttagacag C A G - C C - G G - C G - C A - T G - C T A T C G T C C A C G A A | + | | | G T C G A G G T A G G C G | | | + T T G G C T T T A G AGGTC T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |