Sequence ID | >WENV170644879 |
Genome ID | JMBX01000014 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 26218 |
End posion on genome | 26290 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aaaccaataa |
tRNA gene sequence |
GCCCCCGTAGCTCAATGGATAGAGCGCCGGTCTTCTAAACCGTAGGTTCCGCGTTCGAGT |
Downstream region at tRNA end position |
cactctttaa |
Secondary structure (Cloverleaf model) | >WENV170644879 Arg TCT a Ggtg cactctttaa G G C - G C - G C - G C - G C - G G - C T G T G G C G C A T A A A | | | | | G G C T C G C C G C G C G | | | | T T A G A G C T A G AGGTT C T C - G G - C G - C T - A C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |