Sequence ID | >WENV170644884 |
Genome ID | JMBX01000015 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 34206 |
End posion on genome | 34291 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tttaaacaat |
tRNA gene sequence |
GCGGGAGTGGCGGAACTGGCAGACGCGCTAGACTTAGGATCTAGTGTCTTTGACGTGGGG |
Downstream region at tRNA end position |
aaggaattgg |
Secondary structure (Cloverleaf model) | >WENV170644884 Leu TAG t ACCA aaggaattgg G - C C - G G - C G - C G - C A - T G - C T G T T C T C C A C A A G + | + | | A T G G C G G G G G G C G | | | T T G A C G C C A G G TGTCTTTGACGTGG C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |