Sequence ID | >WENV170644889 |
Genome ID | JMBX01000036 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 11520 |
End posion on genome | 11594 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ctcgcgccgg |
tRNA gene sequence |
GGGGGTGTGGCGCAGACGGCTAGCGCGCTGCGTTTGGGACGCAGAGGTCGTCGGTTCAAG |
Downstream region at tRNA end position |
tttgtttaaa |
Secondary structure (Cloverleaf model) | >WENV170644889 Pro TGG g ACtt tttgtttaaa G G G - C G - C G - C G - C T - A G - C T G T C A G C C A A G A G | | | | | A C C G C G G T C G G C G | | | | T T G G C G C C T A G AGGTC C - G T - A G - C C - G G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |