Sequence ID | >WENV170644956 |
Genome ID | JMBX01000386 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 7122 |
End posion on genome | 7195 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
aaaaaaatat |
tRNA gene sequence |
GGGCCCATGGCGCAGTTGGGAGCGCGTCTCAATGGCATTGAGAAGGTCGAGAGTTCGAAT |
Downstream region at tRNA end position |
aaaacgaaca |
Secondary structure (Cloverleaf model) | >WENV170644956 Ala GGC t ACtc aaaacgaaca G - C G - C G + T C - G C - G C - G A - T T A T C T C T C A T G A G | | | | | G T C G C G G A G A G C G | | | | T T G G C G C G A G AGGTC T - A C - G T - A C - G A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |