Sequence ID | >WENV170644960 |
Genome ID | JMBX01000406 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 80 |
End posion on genome | 6 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aaaatttaat |
tRNA gene sequence |
TCTTCAGTAGCTCAGTCGGTTAGAGCATCTGACTGTTAATCAGAGGGTCGCTGGTTCAAG |
Downstream region at tRNA end position |
aaannnnnnn |
Secondary structure (Cloverleaf model) | >WENV170644960 Asn GTT t GCag aaannnnnnn T - A C - G T - A T - A C - G A - T G - C T G T C G A C C A T G A A | | | | | A C C T C G G C T G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |