Sequence ID | >WENV170644983 |
Genome ID | JMBX01000601 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1034 |
End posion on genome | 1111 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
gctcacgatG |
tRNA gene sequence |
GCCCCCATAGGATAATGGTTAGTCCATTGGATTCTCAGTCCAAGAGTCAGGGTTCGATTC |
Downstream region at tRNA end position |
Accccatcta |
Secondary structure (Cloverleaf model) | >WENV170644983 Glu CTC G TGCC Accccatcta G - C C - G C - G C - G C - G C - G A G C T T T G T C C T T A A A | + | A G T A G G A G G G T G G + | | | T C T G T C C T A A GAGTC T - A T - A G - C G - C A - T T G T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |