Sequence ID | >WENV170644984 |
Genome ID | JMBX01000628 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 7296 |
End posion on genome | 7220 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
taagtaaggg |
tRNA gene sequence |
GGGGAATTAGCTCAGCAGGTTAGAGTGCTACGCTCACATCGTAGAGGCCGTAGGTTCGAG |
Downstream region at tRNA end position |
tcatgggggg |
Secondary structure (Cloverleaf model) | >WENV170644984 Val CAC g ACCA tcatgggggg G - C G - C G - C G - C A - T A - T T - A T G T C A T C C A C G A A | | | | | G A C T C G G T A G G C G | | | + T T G G A G T T T A G AGGCC C - G T - A A - T C - G G - C C T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |