Sequence ID | >WENV170645004 |
Genome ID | JMBX01000911 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 2061 |
End posion on genome | 2146 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
agttttttta |
tRNA gene sequence |
GGGCAGTTACCAGAGTGGCCAAATGGGGCTGACTGTAACTCAGCTGGCTTACGCCTTCGG |
Downstream region at tRNA end position |
aattgtaagt |
Secondary structure (Cloverleaf model) | >WENV170645004 Tyr GTA a ACGA aattgtaagt G - C G - C G - C C - G A - T G - C T - A T A T C T A C C A T G A A | + | | | G G G A C C G G T G G C G | | | T T C A T G G C A A G TGGCTTACGCCTTC G - C C - G T - A G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |