Sequence ID | >WENV170645066 |
Genome ID | JMBX01002235 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1514 |
End posion on genome | 1597 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ttcacatttt |
tRNA gene sequence |
CGGGATGTAGCTCAGTCCGGTTTAGAGTACGCGTCTGGGGGGGGCGTGGGGGGGTCGGAA |
Downstream region at tRNA end position |
aaacagtcaa |
Secondary structure (Cloverleaf model) | >WENV170645066 Pro GGG t ACAA aaacagtcaa C - G G - C G - C G - C A - T T - A G - C T A T T C T T C A C T G A A + | | | | G C C T C G G G A A G C G | | | + T T G G A G T T T T A A TGGGGGGGTC C - G G - C C - G G G T + G C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |