Sequence ID | >WENV170645100 |
Genome ID | JMBX01004377 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 963 |
End posion on genome | 1035 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tcgtccacac |
tRNA gene sequence |
GGGCGCGTAGCTCAATGGTAGAGCAGCGGCCTTTTAAGCCGTTTGTTGGGAGTTCGATCC |
Downstream region at tRNA end position |
tttttttatt |
Secondary structure (Cloverleaf model) | >WENV170645100 Lys TTT c TCat tttttttatt G - C G G G - C C - G G - C C C G - C C T T C C C T C A A A A | | | | | G T C T C G G G G A G C G | | | | T T G G A G C T A A TTGTT G + T C - G G - C G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |