Sequence ID | >WENV170645122 |
Genome ID | JMBX01005684 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 283 |
End posion on genome | 197 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgttagttgt |
tRNA gene sequence |
GCCCGAGTGCTGGAACAGGCAGACAGGACGGTCTCAAAAACCGTTGTCCGCGAGGGCGTG |
Downstream region at tRNA end position |
gctttacaat |
Secondary structure (Cloverleaf model) | >WENV170645122 Leu CAA t ACCA gctttacaat G - C C - G C - G C - G G - C A - T G - C C C T C A G C C A C A A G | | | | | G A G G T C G T C G G C G | | | T T G A C A G C A G G TGTCCGCGAGGGCGT A - T C - G G - C G - C T - A C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |