Sequence ID | >WENV170645128 |
Genome ID | JMBX01006108 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 844 |
End posion on genome | 765 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tccattgcaa |
tRNA gene sequence |
GCCAATGTAGCTCAGGGGGGTAGAGCACTTCCTTGGTAAGGAAGGGGGGGTCACGAGTTC |
Downstream region at tRNA end position |
atttagtatt |
Secondary structure (Cloverleaf model) | >WENV170645128 Thr GGT a TCAA atttagtatt G - C C - G C - G A - T A - T T - A G - C T T T T G C T C A G G A A | | | | | A G C T C G A C G A G C G | | | | T T G G A G C G T A A GGGGGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |