Sequence ID | >WENV170645131 |
Genome ID | JMBX01006525 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 792 |
End posion on genome | 712 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tctcacgttt |
tRNA gene sequence |
GCGCTGGTGCTGGAATTGGCAGACAGGCCTGGTTGAGGGCCAGGTGTCGAAGAGTGAGGG |
Downstream region at tRNA end position |
aaaaggagca |
Secondary structure (Cloverleaf model) | >WENV170645131 Leu GAG t ACac aaaaggagca G - C C - G G - C C - G T - A G - C G + T T C T C T C C C A T A A G | | | | | A T G G T C G A G G G C G | | | T T G A C A G C A G G TGTCGAAGAGT C - G C - G T - A G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |