Sequence ID | >WENV170645207 |
Genome ID | JMBX01018788 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 182 |
End posion on genome | 109 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
gctcgcctgC |
tRNA gene sequence |
GTCCCGATAGGGTAGTGGATATCCTTGAGGCCTGCGGAGCCTTAGACCTGAGTTCAAGTC |
Downstream region at tRNA end position |
ttcttatcct |
Secondary structure (Cloverleaf model) | >WENV170645207 Arg GCG C GTaa ttcttatcct G - C T - A C - G C - G C - G G - C A - T T G T G A C T C A T G A A | | | | | A G T G G G C T G A G C G | | + T T A T C C T T A T AGAC G + T A - T G - C G - C C - G C A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |