Sequence ID | >WENV170645208 |
Genome ID | JMBX01018803 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 73 |
End posion on genome | 149 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ttaaatgggg |
tRNA gene sequence |
GGCCTGGTAGTTCAGATGGTTAGAATGCCAGCCTGTCACGCTGGAGGTCGAGGGTTCGAG |
Downstream region at tRNA end position |
aatcctggtg |
Secondary structure (Cloverleaf model) | >WENV170645208 Asp GTC g GCCA aatcctggtg G - C G + T C - G C - G T - A G - C G - C T G T T T C C C A A G A A + | | | | G T C T T G G A G G G C G | | | + T T G G A A T T T A G AGGTC C - G C - G A - T G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |