Sequence ID | >WENV170645213 |
Genome ID | JMBX01020544 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 241 |
End posion on genome | 313 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tcgcgctcac |
tRNA gene sequence |
GCCAACGTAGCTCAGTCGGTAGAGCAGACGCTTCGTAAGCGCCCGGTCGGGGGTTCGATT |
Downstream region at tRNA end position |
gtttaatctg |
Secondary structure (Cloverleaf model) | >WENV170645213 Thr CGT c Tttt gtttaatctg G - C C - G C - G A - T A - T C - G G - C T T T T T C C C A T G A A + + | | | G C C T C G G G G G G C G | | | | T T G G A G C T A A CGGTC G - C A C C - G G - C C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |