Sequence ID | >WENV170645221 |
Genome ID | JMBX01022668 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 81 |
End posion on genome | 156 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttatttatat |
tRNA gene sequence |
CGCGGAGTGGAGCAGCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTAGGTTCAAAT |
Downstream region at tRNA end position |
aaatggtccc |
Secondary structure (Cloverleaf model) | >WENV170645221 Met CAT t ACCA aaatggtccc C A G - C C - G G - C G - C A - T G - C T A T C T T C C A C G A G | | | | A T C G A G G T A G G C G | | | | T T G G C T C T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |