Sequence ID | >WENV170645223 |
Genome ID | JMBX01022668 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 241 |
End posion on genome | 316 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ccgccatttt |
tRNA gene sequence |
GGCTCAGTAGCTCAGTCGGTAGAGCAAAGGACTGAAAATCCTTGTGTCGGTGGTTCGATT |
Downstream region at tRNA end position |
tctggagtct |
Secondary structure (Cloverleaf model) | >WENV170645223 Phe GAA t ACCA tctggagtct G - C G - C C - G T - A C - G A - T G - C T T T C C G C C A T G A A | | + | | G C C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |