Sequence ID | >WENV170645228 |
Genome ID | JMBX01022821 |
Phylum/Class | [JMBX] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 169 |
End posion on genome | 95 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gcaagcatat |
tRNA gene sequence |
GCGGAAGTGGCTCAGTGGTAGAGCATCGCCTTGCCAAGGCGAGGGCCGCGGGTTCGAATC |
Downstream region at tRNA end position |
aaacttatag |
Secondary structure (Cloverleaf model) | >WENV170645228 Gly GCC t TCCA aaacttatag G - C C - G G - C G - C A - T A - T G - C T A T T G C C C A G A G + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A GGGCC T - A C - G G - C C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |