Sequence ID | >WENV170645287 |
Genome ID | JMSV01000021 |
Phylum/Class | [JMSV] bioreactor metagenome; Culture-2 Bioreactor Bmz derived from microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 32005 |
End posion on genome | 32079 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ttgcatacgt |
tRNA gene sequence |
GGCCCCTTGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACAGGAGTTCGATTC |
Downstream region at tRNA end position |
aaagctcaat |
Secondary structure (Cloverleaf model) | >WENV170645287 Glu TTC t ACCA aaagctcaat G - C G + T C - G C - G C - G C - G T - A T T T T C C T C A C G A G | | | | | G G A C T G A G G A G C G | | | T T T A G A C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |