Sequence ID | >WENV170645295 |
Genome ID | JMSV01000021 |
Phylum/Class | [JMSV] bioreactor metagenome; Culture-2 Bioreactor Bmz derived from microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 2774 |
End posion on genome | 2701 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gctccaatat |
tRNA gene sequence |
GGCGCCATAGCCAAGTGGTAAGGCCGAGGTCTGCAAAATCTCCATCCCCAGTTCAAGTCT |
Downstream region at tRNA end position |
aagaaccacc |
Secondary structure (Cloverleaf model) | >WENV170645295 Cys GCA t TCCA aagaaccacc G - C G - C C - G G - C C - G C - G A - T T G T G G G T C A G A A | | | | | A T A C C G C C C A G C G | | | T T G A G G C T A C CATC G - C A - T G - C G + T T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |