Sequence ID | >WENV170645305 |
Genome ID | JMSV01000044 |
Phylum/Class | [JMSV] bioreactor metagenome; Culture-2 Bioreactor Bmz derived from microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 7216 |
End posion on genome | 7142 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gttataacat |
tRNA gene sequence |
TGGGGTGTCGCCAAGCGGTAAGGCACAGCACTTTGACTGCTGTATGCGTAGGTTCAAATC |
Downstream region at tRNA end position |
agaaacacat |
Secondary structure (Cloverleaf model) | >WENV170645305 Gln TTG t GCCA agaaacacat T - A G - C G - C G - C G - C T - A G - C T A T C G T C C A G A C | + | | | A C A C C G G T A G G C G | | | T T G A G G C T A A TATGC C - G A - T G - C C - G A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |